CHAPTER 12

INFECTION ACTIVATED…

ATGCATTGCAGGTACTAGGTAAGTTACGTAAG <<Charismaximus source code: Morpheus Juice <<searching: Propagation vector…host blood cell. Chi acupoint mapping device: ACTIVATED. Liver Channel: Zhongdu. Timecode acquisition: 'the old man trembles at the touch.' <<streaming: through the Governor Vessel Channels <<<crossing: the blood-brain barrier at Yinjiao <<<settling: in the dream reservoir of the hypothalamus. Splash! something stirs at Xinhui<<<

<<<Host identity = 'Colonel Santiago'. Host Xinhui data grab = 'hunting the stray zeenies down like rats purging the country well so they said their orders were mutterings on the telephone line this was the problem a social problem packed up in black bags and so now i'm a garbage man flying low altitude over the sea and throwing the waste products overboard poor little things the blades keeping time in a steady rhythm when all i ever really wanted to be was a gaucho like rudy valentino in that movie a great lover how he could slay them doing the midnight tango.' <Synaptic flare-path LOCATED. source code: Variation 3 <<<

<<<running: NEUROCHEMICAL ICON VALUE = VALENTINO < Zeno filing run through all Meridian Channels: complete: <Rudolph Valentino (Rodolfo di Valentini; born 1895, Italy; died 1926, USA; cause of death: inflammation of the abdominal wall.) Silent movie actor, celebrated for his exotic persona and sexual mystique. Key appearances: The Four Horsemen of the Apocalypse (1921), The Sheik (1921) and The Young Rajah (1922) <<<

<<<piercing: Heart Channels (desires, longings…) <<'one in particular haunts me a green-eyed little zeeny made of soft bone and animal skin her bare feet used to strike the packed earth of a cellar it was an illicit affair she seems to ride me now like a demon i cannot shake her off.' <(legal notice: a Skull Garden production. Charisma & Charismaximus & Morpheus are registered trademarks. The likeness, effects and emotional content of Rudolph Valentino belong exclusively to the Zeno Corporation.)

<<<dialing: option setting< Stomach Channel: Wuyi <<dissolving: mirror system<< Energizer Channels. masking: <Conception Vessel Channels (sight, sound, taste, touch, smell). Splash! <<sensory corruption process INITIATED < [error message!] << Zigong <<:Accelerate expiry date <<GTCCAGACCTGAATGTTATGGACCAT <<<~

…INFECTION COMPLETE

TOP